|
|
| Year : 2010 | Volume
: 53
| Issue : 1 | Page : 79-82 |
|
| Evaluation and comparison of tests to detect methicillin resistant S. aureus |
|
|
Anila A Mathews, Marina Thomas, B Appalaraju, J Jayalakshmi
Department of Microbiology, PSG Institute of Medical Science and Research, Coimbatore-641 004, India
Click here for correspondence address and email
| Date of Web Publication | 19-Jan-2010 |
|
|
 |
|
 Abstract | | |
Background and Objectives: Phenotypic methods for detection of methicillin resistant Staphylococcus aureus (MRSA) have been compared with the gold standard which, as of now, is by the detection of mecA gene and femA gene by polymerase chain reaction (PCR). Discrepancies in detection have an adverse effect on patient management, thereby highlighting the importance of accuracy in detection. Our study aims to evaluate the efficacy of cefoxitin disk diffusion test to detect MRSA and compare it with other phenotypic and molecular methods. Methodology; The study was conducted from June 2006 to December 2007 and included 610 Staphylococcus aureus (S. aureus) isolates obtained from clinical samples. All isolates were tested for MRSA using oxacillin screen agar plates with 6 µg/ml of oxacillin, cefoxitin disk diffusion using 30 µg disk and MIC of oxacillin. Selected isolates (55) were tested for presence of mecA gene and Fem A gene by PCR. Results: Out of 610 isolates, MRSA was identified in 34.09% by cefoxitin disk diffusion, 34.9% by oxacillin screen agar, 34.4% by MIC and 37.3% by oxacillin disk diffusion. When selected isolates were tested with molecular methods, the cefoxitin disk diffusion and PCR tests were comparable. Discussion: Prevalence of MRSA (34.09%) is quite high as in other studies. The oxacillin disk diffusion test which was used routinely earlier is showing low specificity (56%). Among all phenotypic methods, cefoxitin disk diffusion and PCR alone have similar sensitivity and specificity. Conclusion: Results of cefoxitin disk diffusion test are in concordance with the PCR for mecA gene. Thus, the test can be an alternative to PCR for detection of MRSA in resource constraint settings. Keywords: Cefoxitin, fem A gene, mecA gene, MRSA, Staphylococcus aureus
How to cite this article:
Mathews AA, Thomas M, Appalaraju B, Jayalakshmi J. Evaluation and comparison of tests to detect methicillin resistant S. aureus. Indian J Pathol Microbiol 2010;53:79-82 |
How to cite this URL:
Mathews AA, Thomas M, Appalaraju B, Jayalakshmi J. Evaluation and comparison of tests to detect methicillin resistant S. aureus. Indian J Pathol Microbiol [serial online] 2010 [cited 2023 Jun 3];53:79-82. Available from: https://www.ijpmonline.org/text.asp?2010/53/1/79/59189 |
| Introduction | |  |
Staphylococci are the commonest of all clinical isolates and responsible for several suppurative types of infections. They have a differential ability to spread and cause outbreaks in hospitals. [1] However, treatment of these infections has become problematic due to development of methicillin resistance in S. aureus isolates. Methicillin resistance first appeared among nosocomial isolates of S. aureus in 1961. [1] The incidence of methicillin resistant S. aureus (MRSA) in India ranges from 30 to 70%. [2],[3] MRSA strains harbor the mecA gene, which encodes a modified penicillin binding protein (PBP2' or PBP2a) with low affinity for methicillin and all ß-lactam antibiotics. Since MRSA's are resistant to all β-lactam antibiotics, the therapeutic options are limited significantly. Moreover, the incidence of nosocomial infections caused by MRSA continues to increase world wide, and therefore the importance of their detection, especially for therapeutic and epidemiological purposes arises. Hence methods used to detect MRSA in clinical samples should have high sensitivity and specificity and most importantly the result should be available within a short time.
Phenotypic expression of methicillin resistance may alter depending on the growth conditions for S. aureus such as temperature or osmolarity of the medium, and this may affect accuracy of the methods used to detect methicillin resistance. There are strains of S. aureus that hyper produce betalactamase known as borderline oxacillin resistant S.aureus (BORSA) and while they appear oxacillin resistant, do not possess the usual genetic mechanism for such resistance. There are also strains of S. aureus known as modified S. aureus (MODSA) which possess a modification of existing penicillin binding proteins rather than the acquisition of a new PBP as is the mechanism for classical MRSA. Neither BORSA nor MODSA possess the mecA gene and it is felt that reporting them as MRSA is probably an overcall of resistance. There are many phenotypic methods available for detection of MRSA. Cefoxitin, a cephamycin, is a potent inducer of the mecA regulatory system than penicillins. This study is a comparison of the phenotypic methods with the gold standard which as of now is by the detection of mecA gene and femA gene by polymerase chain reaction (PCR). [4],[5],[6]
| Material and Methods | | |
Between June 2006 and December 2007, S. aureus was isolated from 610 clinical samples taken from various sites including blood, pus, surgical site, diabetic wounds, burn wounds, fracture sites, sputum, tracheal aspirates, central venous pressure tips and urine. All strains were identified by standard procedures. [7] Methicillin resistance was detected among these isolates by disk diffusion tests using oxacillin (one µg) and cefoxitin (30µg) disks, oxacillin resistance screen agar (Himedia, Mumbai, India) and minimum inhibitory concentration (MIC) to oxacillin by agar dilution. [4],[5],[8],[9] Resistance was interpreted using clinical and laboratory standards institute (CLSI) criteria. On the oxacillin screen agar, growth of any number of blue colonies after 24 to 48 hours was indicative of resistance to methicillin. Of the 610 isolates, 55 were subjected to molecular studies for detection of mecA gene. These included nine (out of 20) isolates which showed discrepancy between oxacillin and cefoxitin susceptibility, 35 which were methicillin resistant by both cefoxitin and oxacillin disk diffusion, and 11 which were methicillin sensitive by both cefoxitin and oxacillin disk diffusion tests. Two control strains were included in each run. MRSA ATCC s train No. 43300 and MSSA Oxford strain No. 6571. Molecular detection of mecA gene by PCR was done using the standard procedures. [10],[11] The primers used were:
MecA: Forward primer 5'AATCAGATGGTAAAGGTTGGC3'
Reverse primer 5'AGTTCTGCAGTACCGGATTTGC3'
Fem A : Forward Primer 5'AAAAAAGCACATAACAAGCG3'
Reverse primer 5'GATAAAGAAGAAACGAGCAG3'. (Bangalore Genie)
mecA which codes for Methicillin resistance is of 533 bp and fem A is about 132 bp in size and universally present in all S. aureus isolates. Sensitivity and Specificity was determined to test the performance of detection methods of MRSA. Positive and negative predictive value of the phenotypic tests for detection of MRSA when compared with the Gold Standard was calculated.
| Results | | |
Of the 610 strains of S. aureus isolated from our hospital [Table 1] and [Table 2], 208 (34.09%) were identified as MRSA and 402(65.9%) as MSSA based on cefoxitin susceptibility. Using the oxacillin disk diffusion method, 228 (37.37%) isolates were identified as MRSA and 382(62.6%) as MSSA. As is seen here, 20 isolates (3.2%) showed discrepancy between oxacillin and cefoxitin susceptibility results. Surgical site wound (25%) and diabetic foot (24%) infections were the predominant sites from where MRSA were isolated. [Figure 1]
MIC of Oxacillin by agar dilution method [Table 3]: All the isolates resistant to both cefoxitin and oxacillin had an MIC over 16µg/ml. All the isolates sensitive to oxacillin and cefoxitin by disk diffusion method had MICs of between 0.5-2µg/ml. (MIC les than two µg/ml is interpreted as MSSA - CLSI criteria) The 20 isolates which were sensitive to cefoxitin but resistant to oxacillin by disk diffusion method had MICs of four to eight µg/ml. An MIC of four µg/ml was seen in two isolates which were methicillin sensitive by cefoxitin disk diffusion method but resistant by the MIC method. There were no isolates that were sensitive to oxacillin but resistant to cefoxitin.
PCR for detection of mecA gene [Table 4] and [Table 5] [Figure 2] : Among the 55 isolates tested for mecA gene, 35 showed presence of the gene whereas in 20 isolates they were absent. All the nine isolates which were methicillin sensitive by cefoxitin disk diffusion but resistant by oxacillin disk diffusion were negative for mecA gene. The two isolates which were methicillin sensitive by cefoxitin disk diffusion but resistant by MIC (oxacillin) agar dilution method were also negative for mecA gene.
| Discussion | | |
For the past 50 years, S. aureus has been a dynamic human pathogen that has gained the deepest respect of clinicians since the first report of MRSA infection in US at a Boston city hospital in1961. Since then MRSA has become widespread all over the world. In our hospital too, a prevalence of 34% is seen which is similar to other studies. [12],[13] As compared to the high specificity of cefoxitin disk diffusion method, oxacillin disk diffusion method was only 56% specific. Similar results were quoted by Swenson et al. in their phase one study. [14] Most other studies report better specificity with oxacillin disk diffusion method. [14],[15],[16] The high false positivity (45%) of oxacillin disk diffusion method in this study could be due to hyper production of betalactamase which may lead to phenotypic expression of oxacillin resistance. [14] This was corroborated by the fact that all the isolates that were resistant to oxacillin but sensitive to cefoxitin were negative for mecA gene and their MIC was between 4-8µg /ml. These strains of S. aureus that were resistant to oxacillin but sensitive to cefoxitin and negative for mecA gene probably are BORSA that hyper produce betalactamase and while they appear oxacillin resistant do not possess the usual genetic mechanism for such resistance. Probably these strains under antibiotic pressure may evolve into fully resistant isolates subsequently (MIC of these isolates were higher than that of those that were sensitive to both cefoxitin and oxacillin). These isolates were reported as methicillin sensitive based on cefoxitin sensitivity and all the patients infected with these isolates responded well to cephalosporins and cloxacillin. Determination of MIC of oxacillin for isolates that show such discrepancy will give additional information. Detection of mecA gene will be a confirmation of methicillin resistance. Several groups of investigators have reported that the results of cefoxitin disk diffusion method correlates better with the presence of mecA than oxacillin disk diffusion method. [14],[15]
All other methods including oxacillin screen agar and MIC detection by dilution methods had a sensitivity and specificity similar to that of other studies. [13],[17],[18] Errors in detection of methicillin resistance as can happen when using oxacillin disk can have serious adverse consequence for patient management, where in, patients harboring methicillin sensitive strains when reported as methicillin resistant has an increased chance of misuse of glycopeptides. Therefore, detection of methicillin resistance in laboratories should be conducted with meticulous care, keeping in mind the sensitivity and specificity of methods used for detection of MRSA. False resistance may increase the health care cost following unnecessary isolation precautions and may lead to over use of glycopeptides.
| Conclusion | | |
In our study, cefoxitin disk diffusion method was found to be better than oxacillin disc diffusion method. In a country like India where molecular methods are not feasible as a routine, cefoxitin is a good surrogate marker for methicillin resistance. However, a constant surveillance of cefoxitin disk diffusion method is needed as to its sensitivity and specificity, because when oxacillin disc diffusion was recommended as the method of choice for routine detection of MRSA, we did not fathom that it would become redundant after some years.
| References | | |
| 1. | Barber M. Methicillin Resistant Staphylococci. J Clin Pathol 1961;14:385-93.  |
| 2. | Verma S, Joshi S, Chitnis V, Hemwani N, Chitnis D. Growing problems of Methicillin Resistance Staphylococci - Indian Scenario. Indian J Med Sci 2000;54:535-40. |
| 3. | Rajaduraipandi K, Mani KR, Panneerselvam K, Mani M, Bhaskar M and Manikandan P. Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: A multicentre study. Indian J Med Microbiol 2006;24:34-8. [PUBMED]  |
| 4. | Brown DF, Edward DI, Hawkey P. Guidelines for Laboratory Diagnosis and Susceptibility Testing of Methicillin Resistant Staphylococcus aureus. J Antimicrob Chemother 2005;56:1000-8. |
| 5. | Clinical and Laboratory Standards Institute (CLSI) Preference Standards for Antimicrobial Disk Susceptibility test. Approved standards M2-A7, 11 th ed. Wayne, Pa: 2005. |
| 6. | Clinical and Laboratory Standards Institute / NCCLS Performance standards for Antimicrobial disc diffusion tests; Approved standards. 9 th ed. CLSI Document M2-M9. Wayne Pa: Clinical and Laboratory Standards Institute; 2006. |
| 7. | Koneman EW, Allen SD, Janda WM, Schreckenberger PC, Winn WC Jr, Procop G, et al. Koneman Colour Atlas and Text Book of Diagnostic Microbiology. 6 th ed. Chapter 12, p. 624-61 |
| 8. | Kircher S, Dick N, Ritter V, Sturm K, Warns P. Detection of Methicillin resistant Staphylococcus aureus using a new medium, BBL TM Chromeagar MRSA compared to current methods. presented at 104 th General Meeting of the American Society for Microbiology. New Orleans, L.A: 2004. |
| 9. | Swenson JM, Spargo J, Tenover FC, Ferraro MJ. Optimal inoculation methods and quality control for the NCCLS oxacillin agar screen test for detection of oxacillin resistance in Staphylococcus aureus. J Clin Microbiol 2001;39:3781-4. |
| 10. | Japoni A, Alborzi A, Rasouli M, and Pourabbas B. 'Modified DNA extraction for rapid PCR detection of Methicillin Resistant Staphylococcus' Iranian Biomedical J 2004;8:161-5. |
| 11. | Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of Methicillin-resistant strains of Staphylococci by Polymerase chain reaction. J Clin Microbiol 1991;29:2240-4. |
| 12. | Anupurba S, Sen MR, Nath G, Sharma BM, Gulati AK, Mohapatra TM, et al. Prevalence, of Methicillin Resistant Staphylococcus aureus at a teritary care Referral Hospital in East Uttarpradesh. Indian J Med Microbiol 2003;21:49-51. [PUBMED] |
| 13. | Fernandes CJ, Fernandes LA, Collignon P; Australian Group on Antimicrobial Resistance 'Cefoxitin resistance as a surrogate marker for the detection of methicillin-resistant Staphylococcus aureus'. J Antimicrob Chemother 2005;55:506-10 |
| 14. | Swenson JM, Tenover FC. Cefoxitin disk study group. Results of Disk diffusion testing with Cefoxitin correlate with presence of mecA in Staphylococcus sp. J Clin Microbiol 2005 ; 43:3818-28. |
| 15. | Felten A, Grandy B, Lagrange PH, Casin I. Evaluation of three techniques for detection of low level methicillin-resistant Staphylococcus aureus (MRSA): A disk diffusion method with cefoxitin and moxalactam, the Vitek 2 system, and the MRSA-screen latex agglutination test. J Clin Microbiol 2002;40:2766-71. |
| 16. | Skov R, Smyth R, Clausen M, Larsen AR, Frimodt-Møller N, Olsson-Liljequist B, et al. Evaluation of a cefoxitin 30 µg disk on Iso-Sensitest agar for detection of methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother 2003;52:204-7. |
| 17. | Velasco D, del Mar Thomas MD, Cartelle M, Beceiro A, Perez A, Moina F, et al. Evaluation of different methods for detecting oxacillin resistance in Staphylococcus aureus. J Antimicrob Chemother 2005;55:379-8217. |
| 18. | Swenson JM, Lonsway D, McAllister S, Thompson A, Jevitt L, Patel JB. Detection of mecA-mediated Resistance Using Cefoxitin Disk Diffusion (DD) in a collection of Staphylococcus aureus expressing borderline oxacillin MICs. Diagn Microbiol Infect Dis 2007;58:33-9. |
Correspondence Address:
Anila A Mathews
Department of Microbiology, PSG Institute of Medical Science and Research, Coimbatore-641 004
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0377-4929.59189
[Figure 1], [Figure 2]
[Table 1], [Table 2], [Table 3], [Table 4], [Table 5] |
|
| This article has been cited by | | 1 |
Epidemiology of clinically isolated methicillin-resistant Staphylococcus aureus (MRSA) and its susceptibility to linezolid and vancomycin in Egypt: a systematic review with meta-analysis |
|
| Ahmed Azzam, Heba Khaled, Maha Mosa, Neveen Refaey, Mohammed AlSaifi, Sarah Elsisi, Fatma Khaled Elagezy, May Mohsen | | BMC Infectious Diseases. 2023; 23(1) | | [Pubmed] | [DOI] | | | 2 |
Phenotypic and Genotypic Characterization of Methicillin Resistance in Staphylococci Isolated from an Egyptian University Hospital |
|
| Marwa A. Abdelwahab, Wesam H. Amer, Dalia Elsharawy, Reham M. Elkolaly, Rehab Abd El Fattah Helal, Dina Ahmed El Malla, Yomna G. Elfeky, Hebatallah A. Bedair, Rania S. Amer, Marwa E. Abd-Elmonsef, Marwa S. Taha | | Pathogens. 2023; 12(4): 556 | | [Pubmed] | [DOI] | | | 3 |
Detection of mecA gene-associated methicillin-resistance coagulase-negative staphylococci (MRCoNS) from bovine mastitis in Gujarat |
|
| Bhavesh Ishwarbhai Prajapati, K M SOLANKI, R D SINGH, A C PATEL, R M PATEL, B P KATIRA | | The Indian Journal of Animal Sciences. 2022; 92(8): 935 | | [Pubmed] | [DOI] | | | 4 |
Prevalence and genetic lineages of Staphylococcus aureus nasal colonization and urinary tract infection among people living with HIV/AIDS infected persons in Nigeria: A systematic review |
|
| Idris Nasir Abdullahi, Rabeb Issaoui, Yahaya Usman | | IJID Regions. 2022; 4: 17 | | [Pubmed] | [DOI] | | | 5 |
Comparison of Phenotypic and Genotypic Characterization Methods for the Detection of Methicillin-Resistant Staphylococcus Aureus |
|
| Rajeswarie S, Pradha V, Annet Olinda D'Souza, R Vinod | | Cureus. 2022; | | [Pubmed] | [DOI] | | | 6 |
Isolation, characterisation and antibiotic susceptibility of staphylococcal isolates with special reference to methicillin-resistant Staphylococcus aureus from the anterior nares of healthcare workers in A tertiary healthcare centre |
|
| Mukul Chaurasia, Neha Agrawa, Ankita Chourasia, Monica Bhatnagar, Geeta Parihar, Vijaylatha Rastogi, Amit Tak | | Scripta Medica. 2021; 52(2): 85 | | [Pubmed] | [DOI] | | | 7 |
Prevalence pattern of MRSA from a rural medical college of North India: A cause of concern |
|
| Kirti Lohan, Jyoti Sangwan, Pratibha Mane, Sumit Lathwal | | Journal of Family Medicine and Primary Care. 2021; 10(2): 752 | | [Pubmed] | [DOI] | | | 8 |
Perspective for Methicillin-resistant Staphylococcus Aureus colonization, Antibiotic Susceptibility Patterns and Risk factors for Colonization among People Living with HIV at Nyenga Hospital, Buikwe District, in Central Uganda |
|
| Benedict Ssenyonga, Sarah Mwebaze, Christine Atuhairwe, Ivan MugishaTaremwa, HamidReza Naderi | | International Journal of Infection Prevention. 2020; 1(1): 1 | | [Pubmed] | [DOI] | | | 9 |
A prospective study to evaluate methods of MRSA detection in patients with soft tissue and bone infection in a tertiary care centre |
|
| Serra Saji Moses, Thomas S Kuruvilla, Thressia Thomas | | Indian Journal of Microbiology Research. 2020; 7(2): 154 | | [Pubmed] | [DOI] | | | 10 |
A Systemic Literature Review and Meta-Analysis Reporting the Prevalence and Impact of Methicillin-ResistantStaphylococcus aureusInfection in India |
|
| Canna Jagdish Ghia, Shaumil Waghela, Gautam Rambhad | | Infectious Diseases: Research and Treatment. 2020; 13: 1178633720 | | [Pubmed] | [DOI] | | | 11 |
Genotyping of long term persistent Staphylococcus aureus in bovine subclinical mastitis |
|
| B.F. Rossi,E.C.R. Bonsaglia,I.G. Castilho,S.T.A. Dantas,A. Salina,H. Langoni,J.C.F. Pantoja,P.E. Budri,D. Fitzgerald-Hughes,A. Fernandes Júnior,V.L.M. Rall | | Microbial Pathogenesis. 2019; 132: 45 | | [Pubmed] | [DOI] | | | 12 |
Vancomycin Resistance Among Methicillin Resistant Staphylococcus aureus Isolates from Neonatal Sepsis Attending Intensive Care Unit in Shibin El-Kom Teaching Hospital, Egypt |
|
| Mahmoud AbdEl-Mongy, Elham Taha Awad, Fatma Mosaed | | Journal of Pure and Applied Microbiology. 2018; 12(3): 1093 | | [Pubmed] | [DOI] | | | 13 |
Isolation, Characterization, and Antibacterial Activity of Bacteriophages Against Methicillin-Resistant Staphylococcus aureus in Pakistan |
|
| Muhammad Hidayat Rasool,Rukhsana Yousaf,Abu Baker Siddique,Muhammad Saqalein,Mohsin Khurshid | | Jundishapur Journal of Microbiology. 2016; 9(10) | | [Pubmed] | [DOI] | | | 14 |
Prevalence of Methicillin Resistant Staphylococcus aureus among Egyptian Patients after Surgical Interventions |
|
| Eman F. Ahmed,Gamal F.M. Gad,Ahlam M. Abdalla,Ayman M. Hasaneen,Sayed F. Abdelwahab | | Surgical Infections. 2014; 15(4): 404 | | [Pubmed] | [DOI] | | | 15 |
MRSA decolonization: success rate, risk factors for failure and optimal duration of follow-up |
|
| P. Kohler,A. Bregenzer-Witteck,G. Rettenmund,S. Otterbech,M. Schlegel | | Infection. 2013; 41(1): 33 | | [Pubmed] | [DOI] | | | 16 |
Heterogeneity in <i>femA</i> in the Indian Isolates of <i>Staphylococcus aureus</i> Limits Its Usefulness as a Species Specific Marker |
|
| Rosy Chikkala,Nikhil Oommen George,Kamaraju S. Ratnakar,Ranganathan Natarajan Iyer,Venkataraman Sritharan | | Advances in Infectious Diseases. 2012; 02(03): 82 | | [Pubmed] | [DOI] | | | 17 |
Evaluation of five phenotypic methods for detection of methicillin resistant staphylococcus aureus (MRSA) |
|
| Karami, S., Rahbar, M., Yousefi, J.V. | | Iranian Journal of Pathology. 2011; 6(1): 27-31 | | [Pubmed] | | | 18 |
Evaluation of methicillin resistance Staphylococcus aureus isolated from patients in Golestan province-north of Iran |
|
| Vaez, H., Tabaraei, A., Moradi, A., Ghaemi, E.A. | | African Journal of Microbiology Research. 2011; 5(4): 432-436 | | [Pubmed] | | | 19 |
MRSA admission screening in a low prevalence setting - Much ado about nothing? |
|
| Witteck, A., Rettenmund, G., Schlegel, M. | | Swiss Medical Weekly. 2011; 141(7) | | [Pubmed] | | | 20 |
Antimicrobial susceptibility of staphylococci sp. Isolated from bovine milk |
|
| Kim, J., Ko, M., Kim, K., Lee, S., Choi, S. | | Korean Journal of Microbiology. 2010; 46(4): 341-345 | | [Pubmed] | | | 21 |
Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant staphylococcus aureus |
|
| Shariati, L., Validi, M., Tabatabaiefar, M.A., Karimi, A., Nafisi, M.R. | | Current Microbiology. 2010; 61(6): 520-524 | | [Pubmed] | | | 22 |
Comparison of Real-Time PCR with Disk Diffusion, Agar Screen and E-test Methods for Detection of Methicillin-Resistant Staphylococcus aureus |
|
| Laleh Shariati,Majid Validi,Mohammad Amin Tabatabaiefar,Ali Karimi,Mohammad Reza Nafisi | | Current Microbiology. 2010; 61(6): 520 | | [Pubmed] | [DOI] | |
|
|
|
|
|
|
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 10890 | | | Printed | 320 | | | Emailed | 10 | | | PDF Downloaded | 940 | | | Comments | [Add] | | | Cited by others | 22 | | |
|
|
